The Metabolic Basis of Inherited Disease, pp.3705-3716, 1995. ,
Lowe syndrome protein OCRLl interacts with clathrin and regulates protein trafficking between endosomes and the ,
Differential Clathrin Binding and Subcellular Localization of OCRL1 Splice Isoforms, Journal of Biological Chemistry, vol.284, issue.15, pp.9965-73, 2009. ,
DOI : 10.1074/jbc.M807442200
Lenticular Opacities in Carriers of Lowe's Syndrome, Ophthalmology, vol.93, issue.8, pp.1041-1046, 1986. ,
DOI : 10.1016/S0161-6420(86)33623-6
Quality control in molecular genetic testing, Nature Reviews Genetics, vol.2, issue.9, pp.717-740, 2001. ,
DOI : 10.1038/35088588
Hypercalciuric rickets associted with Tenal tubular damage, 1964. ,
Phosphoinositides in cell regulation and membrane dynamics, Nature, vol.26, issue.7112, pp.651-658, 2006. ,
DOI : 10.1038/nature05185
Expression profiling via novel multiplex assay allows rapid assessment of gene regulation in defined signalling pathways, Nucleic Acids Res, vol.1, pp.31-153, 2003. ,
A Role of the Lowe Syndrome Protein OCRL in Early Steps of the Endocytic Pathway, Developmental Cell, vol.13, issue.3, pp.377-90, 2007. ,
DOI : 10.1016/j.devcel.2007.08.004
Lowe syndrome protein OCRL1 interacts with Rac GTPase in the trans-Golgi network, Human Molecular Genetics, vol.12, issue.19, pp.2449-56, 2003. ,
DOI : 10.1093/hmg/ddg250
Lowe's syndrome: identification of carriers by lens examination., Journal of Medical Genetics, vol.13, issue.6, pp.449-54 ,
DOI : 10.1136/jmg.13.6.449
How Rab proteins link motors to membranes, Nature Cell Biology, vol.4, issue.4, pp.77-85, 2005. ,
DOI : 10.1038/ncb0402-e77
Communication personnelle, 2005. ,
Nine unk:nown rearrangements in 16p13.3 and 1 lp15.4 causing alpha-and beta thalassaemia characterised by high resolution multiplex ligation-dependent probe amplification, J Med Genet, vol.42, pp.922-953, 2005. ,
Br Sequential gene promoter methylation during HPV-induced cervical carcinogenesis, J Cancer, vol.97, pp.1457-64, 2009. ,
Validation and comparison of two quantitative real-time PCR assays for direct detection of DMD/BMD carriers, Clin Biochem, 2009. ,
Gene expression profiling of minimal residual disease in acute myeloid leukaemia by novel multiplex-PCR-based method, Leukemia, vol.18, issue.12, pp.1981-1989, 2004. ,
DOI : 10.1038/sj.leu.2403520
A balanced de novo X/autosome translocation in a girl with manifestations of lowe syndrome, American Journal of Medical Genetics, vol.18, issue.3, 1986. ,
DOI : 10.1002/ajmg.1320230311
Large genomic deletions and duplications in the BRCAl gene identified by a novel quantitative method, Cancer Res, vol.63, pp.1449-53, 2003. ,
Aminoaciduria-renal transport, Am J Dis Child, vol.115, pp.169-178, 1968. ,
Dent Disease with mutations in OCRLl, Am J Hum Genet. Am J Hum Genet, vol.7681, issue.2, pp.260-7634, 2005. ,
Membrane targeting and activation of the Lowe syndrome protein OCRLl by rab GTPases, EMBO J, vol.253750, p.61, 2006. ,
MLPA analysis for the detection of deletions, duplications and complex rearrangements in the dystrophin gene: potential and pitfalls, Neurogenetics, vol.11, issue.1, pp.29-35, 2005. ,
DOI : 10.1007/s10048-004-0204-1
A rapid method for the purification of DNA from blood, Nucleic Acids Research, vol.15, issue.22, p.9611, 1987. ,
DOI : 10.1093/nar/15.22.9611
MS-MLPA: an attractive alternative laboratory assay for robust, reliable, and semiquantitative detection of MGMT promoter hypermethylation in gliomas, Laboratory Investigation, vol.349, issue.10, pp.1055-65, 2007. ,
DOI : 10.1038/labinvest.3700664
Cognitive and behavioral profile of the oculocerebrorenal syndrome of Lowe, American Journal of Medical Genetics, vol.19, issue.3, pp.297-303 ,
DOI : 10.1002/ajmg.1320460312
Evidence for a discrete behavioral phenotype in the oculocerebrorenal syndrome of lowe, American Journal of Medical Genetics, vol.92, issue.3, pp.283-290, 1995. ,
DOI : 10.1002/ajmg.1320590304
Identification of 54 large deletions/duplications in TSC1 and TSC2 using MLPA, and genotype-phenotype correlations, Human Genetics, vol.45, issue.3-4, pp.389-400, 2007. ,
DOI : 10.1007/s00439-006-0308-9
New applications and developments in the use of multiplex ligation-dependent probe amplification, ELECTROPHORESIS, vol.40, issue.23, pp.4627-4663, 2008. ,
DOI : 10.1002/elps.200800126
Detecting exon deletions and duplications of the DMD gene using Multiplex Ligation-dependent Probe Amplification (MLPA), Clinical Biochemistry, vol.39, issue.4, pp.367-72, 2006. ,
DOI : 10.1016/j.clinbiochem.2005.11.019
gene in patients with the oculocerebrorenal syndrome of Lowe, Human Molecular Genetics, vol.2, issue.4, pp.461-464, 1993. ,
DOI : 10.1093/hmg/2.4.461
The effect of missense mutations in the RhoGAP-homology domain on ocrl1 function, Molecular Genetics and Metabolism, vol.89, issue.1-2, pp.121-129, 2006. ,
DOI : 10.1016/j.ymgme.2006.04.005
Mutations Are Not Uniformly Distributed throughout theOCRL1Gene in Lowe Syndrome Patients, Molecular Genetics and Metabolism, vol.64, issue.1, pp.58-61, 1998. ,
DOI : 10.1006/mgme.1998.2687
Molecular confinnation of carriers for Lowe syndrome ,
A common molecular basis for three inherited kidney stone diseases, Nature, vol.379, issue.6564, pp.445-449, 1996. ,
DOI : 10.1038/379445a0
Radiological cases of the month. 1992, Am J Dis Child, vol.146, pp.1209-1210 ,
Organic aciduria, decreased renal ammonia production, hydrophtalmos, and mental retardation : a clinical entity, Am J Dis Child, vol.83, pp.164-184, 1952. ,
Structure and Function of the Lowe Syndrome Protein OCRL1, Traffic, vol.99, issue.Pt 3, pp.711-719, 2005. ,
DOI : 10.1111/j.1600-0854.2005.00311.x
An explanation for the phenotypic differences between patients bearing partial deletions of the DMD locus, Genomics, vol.2, issue.1, 1988. ,
DOI : 10.1016/0888-7543(88)90113-9
Report on the Lowe's syndrome comprehensive survey West Lafayette, 1991. ,
Les protéines Rho: leur rôle dans les neurones Med Sei, pp.358-363, 2003. ,
OCRL1 mutation analysis in French Lowe syndrome patients: Implications for molecular diagnosis strategy and genetic counseling, Human Mutation, vol.16, issue.2, pp.157-65, 2000. ,
DOI : 10.1002/1098-1004(200008)16:2<157::AID-HUMU8>3.0.CO;2-9
Lowe oculocerebrorenal syndrome in a female with a balanced X ,
Physical mapping and genomic structure of the Lowe syndrome gene OCRL1, Human Genetics, vol.99, issue.2, pp.145-50, 1997. ,
DOI : 10.1007/s004390050329
Methylation-specific MLPA (MS-MLPA): simultaneous detection of CpG methylation and copy number changes of up to 40 sequences, Nucleic Acids Res, vol.33, p.128, 2005. ,
The oculocerebrorenal syndrome gene product is a 105-kD protein localized to the Golgi complex, Am J Hum Genet, vol.57, pp.817-840, 1995. ,
The role of the inositol polyphosphate 5-phosphatases in cellular function and human disease, Biochemical Journal, vol.419, issue.1 ,
DOI : 10.1042/BJ20081673
Human RhoGAP domain-containing proteins: structure, function and evolutionary relationships, FEBS Letters, vol.130, issue.1-3, pp.27-34, 2002. ,
DOI : 10.1016/S0014-5793(02)03331-8
Identification of a novel deletion of the entire OCRL1 gene detected by FISH analysis in a family with Lowe syndrome, Clinical Genetics, vol.57, issue.9, pp.479-82, 2000. ,
DOI : 10.1034/j.1399-0004.2000.580609.x
A novel domain suggests a ciliary function for ASPM, a brain size determining gene, Bioinformatics, vol.22, issue.9, pp.1031-1036, 2006. ,
DOI : 10.1093/bioinformatics/btl022
MS-MLPA is a specific and sensitive technique for detecting all chromosome 11p15.5 imprinting defects of BWS and SRS in a single-tube experiment, European Journal of Human Genetics, vol.16, issue.5, pp.565-71, 2008. ,
DOI : 10.1038/sj.ejhg.5202001
Molecular diagnosis of Prader-Willi and ,
Subtelomeric deletions detected in patients with idiopathic mental retardation using multiplex ligation-dependent probe amplification (MLPA), Human Mutation, vol.49, issue.1, pp.17-21, 2004. ,
DOI : 10.1002/humu.10300
Carrier Assessment in Families with Lowe Oculocerebrorenal Syndrome: Novel Mutations in the OCRL1 Gene and Correlation of Direct DNA Diagnosis with Ocular Examination, Molecular Genetics and Metabolism, vol.69, issue.3, pp.213-222, 2000. ,
DOI : 10.1006/mgme.1999.2955
Characterization of a germline mosaicism in families with Lowe syndrome, and identification of seven navel mutations in the OCRLl gene, Am J Hum Genet, vol.65, pp.68-76, 1999. ,
Analyse génétique et fonctionnelle du géne OCRLI associé au syndrome de Lowe, Th PhD, 2007. ,
Utility of microsatellite analysis in evaluation of pregnancies with placental mesenchymal dysplasia, Prenatal Diagnosis, vol.10, issue.13, pp.1238-1282, 2007. ,
DOI : 10.1002/pd.1879
Relative quantification of 40 nucleic acid sequences by multiplex ligation-dependent probe amplification, Nucleic Acids Research, vol.30, issue.12, p.57, 2002. ,
DOI : 10.1093/nar/gnf056
OCRLl mutations in patients with Dent disease phenotype in Japan ,
MLPA and MAPH: New techniques for detection of gene deletions, Human Mutation, vol.20, issue.5, pp.413-422, 2004. ,
DOI : 10.1002/humu.20035
Effectiveness of multiplex ligation-dependent probe amplification assay used for detecting deletion of Prader-Willi syndrome, Beijing Da Xue Xue Bao, vol.37, pp.64-71, 2005. ,
Mapping the Lowe oculocerebrorenal syndrome to Xq24-q26 by use of restriction fragment length polymorphisms., Journal of Clinical Investigation, vol.79, issue.1, pp.282-285, 1987. ,
DOI : 10.1172/JCI112795
Lowe Syndrome, a deficiency of a phosphatidyl-inositol 4,5-bisphosphate 5-phosphatase in the Golgi apparatus, Human Molecular Genetics, vol.4, issue.12, pp.2245-50, 1995. ,
DOI : 10.1093/hmg/4.12.2245
The Deficiency of PIP2 5-Phosphatase in Lowe Syndrome Affects Actin Polymerization, The American Journal of Human Genetics, vol.71, issue.6, pp.1420-1427, 2002. ,
DOI : 10.1086/344517
Rapid, high throughput prenatal detection of aneuploidy using a novel quantitative method (MLPA), Journal of Medical Genetics, vol.40, issue.12, pp.907-919, 2003. ,
DOI : 10.1136/jmg.40.12.907
Multiplex ligation-dependent probe amplification using a completely synthetic probe set, Biotechniques, vol.37, pp.399-405, 2004. ,
Dent's disease: a familial proximal renal tubular syndrome with low-molecular-weight proteinuria, hypercalciuria, nephrocalcinosis, metabolic bone disease, progressive renal failure and a marked male predominance, QJM, vol.87, pp.473-493, 1994. ,
A: comprehensive detection of deletions and duplications and its application to DMD patients, Hum Mutat, vol.29, pp.190-197, 2008. ,
The protein deficient in Lowe syndrome is a phosphatidylinositol-4,5-bisphosphate 5-phosphatase., Proc Natl Acad Sei U S A, pp.4853-4859, 1995. ,
DOI : 10.1073/pnas.92.11.4853
Human MLPA Probe Design (H-MAPD): a probe design tool for both electrophoresis-based and bead-coupled human multiplex ligation-dependent probe amplification assays, BMC Genomics, vol.9, issue.1, p.407, 2008. ,
DOI : 10.1186/1471-2164-9-407
tttcccttgacttaagttgattcag 128 CTGGCAGCAACCACTCTGTGGCTGAAGCACTGCTCATTTTCTTGGAAGCCCTGCCAGAGC CAGTCATCTGTTACGAGCTGTATCAGCGATGTCTTGACTCTGCTTATGATCCCCGGATCT GCCGACAG 831 gtgggttctactgacctggggatgt, p.406 ,