D. Ricard, A. Idbaih, F. Ducray, M. Lahutte, K. Hoang-xuan et al., Primary brain tumours in adults, Lancet. 26 mai, vol.379, issue.9830, pp.1984-96, 2012.

Q. T. Ostrom, H. Gittleman, L. Stetson, S. Virk, and J. S. Barnholtz-sloan, Epidemiology of Intracranial Gliomas, vol.30, p.11, 2018.

D. N. Louis, H. Ohgaki, O. D. Wiestler, W. K. Cavenee, P. C. Burger et al., WHO Classification of Tumours of the Central Nervous System, Acta Neuropathol. août, vol.114, issue.2, pp.97-109, 2007.

. Van-den-bent and . Mj, Interobserver variation of the histopathological diagnosis in clinical trials on glioma: a clinician's perspective, Acta Neuropathologica. sept, vol.120, issue.3, pp.297-304, 2010.

D. N. Louis, A. Perry, G. Reifenberger, A. Von-deimling, D. Figarella-branger et al., The 2016 World Health Organization Classification of Tumors of the Central Nervous System: a summary, Acta Neuropathologica. juin, vol.131, issue.6, pp.803-823, 2016.
URL : https://hal.archives-ouvertes.fr/hal-01479018

D. N. Louis, A. Perry, P. Burger, D. W. Ellison, G. Reifenberger et al., International Society of Neuropathology-Haarlem Consensus Guidelines for Nervous System Tumor Classification and Grading: ISN-Haarlem Brain Tumor Classification Guidelines, Brain Pathology. sept, vol.24, issue.5, pp.429-464, 2014.

D. N. Louis, H. Ohgaki, O. D. Wiestler, W. K. Cavenee, and . Lyon, WHO classification of tumours of the central nervous system, vol.408, 2016.

Z. Turkalp, J. Karamchandani, and S. Das, IDH Mutation in Glioma: New Insights and Promises for the Future, JAMA Neurology, vol.71, issue.10, p.1319, 2014.

Y. Kim, S. Nobusawa, M. Mittelbronn, W. Paulus, B. Brokinkel et al., Molecular Classification of Low-Grade Diffuse Gliomas, The American Journal of Pathology. déc, vol.177, issue.6, pp.2708-2722, 2010.

J. S. Smith, A. Perry, T. J. Borell, H. K. Lee, J. O'fallon et al., Alterations of chromosome arms 1p and 19q as predictors of survival in oligodendrogliomas, astrocytomas, and mixed oligoastrocytomas, J Clin Oncol. févr, vol.18, issue.3, pp.636-681, 2000.

A. Idbaih, Y. Marie, G. Pierron, C. Brennetot, K. Hoang-xuan et al., Two types of chromosome 1p losses with opposite significance in gliomas, Ann Neurol. sept, vol.58, issue.3, pp.483-490, 2005.
URL : https://hal.archives-ouvertes.fr/inserm-00310519

H. Ohgaki and P. Kleihues, Genetic profile of astrocytic and oligodendroglial gliomas, Brain Tumor Pathology. juill, vol.28, issue.3, pp.177-83, 2011.

D. Ricard, G. Kaloshi, A. Amiel-benouaich, J. Lejeune, Y. Marie et al., Dynamic history of low-grade gliomas before and after temozolomide treatment, Annals of Neurology. mai, vol.61, issue.5, pp.484-90, 2007.

D. E. Reuss, F. Sahm, D. Schrimpf, B. Wiestler, D. Capper et al., ATRX and IDH1-R132H immunohistochemistry with subsequent copy number analysis and IDH sequencing as a basis for an "integrated" diagnostic approach for adult astrocytoma, oligodendroglioma and glioblastoma, Acta Neuropathologica. janv, vol.129, issue.1, pp.133-179, 2015.

A. Ebrahimi, M. Skardelly, I. Bonzheim, I. Ott, H. Mühleisen et al., ATRX immunostaining predicts IDH and H3F3A status in gliomas, Acta Neuropathologica Communications, vol.4, issue.1

P. For, . Network, E. Tabouret, A. T. Nguyen, C. Dehais et al., Prognostic impact of the 2016 WHO classification of diffuse gliomas in the French POLA cohort, Acta Neuropathologica, vol.132, issue.4, pp.625-659, 2016.

R. Sanou, R. Anxionnat, L. Taillandier, M. A. Bigard, D. Regent et al., , 2009.

D. Sur,

F. Galuppini, E. Opocher, U. Tabori, I. Mammi, M. Edwards et al.,

, Concomitant IDH wild-type glioblastoma and IDH1 -mutant anaplastic astrocytoma in a patient with constitutional mismatch repair deficiency syndrome, Neuropathology and Applied Neurobiology. févr, vol.44, issue.2, pp.233-242, 2018.

M. Hasselblatt, M. Jaber, D. Reuss, O. Grauer, A. Bibo et al., Diffuse Astrocytoma, IDH-Wildtype: A Dissolving Diagnosis, Journal of Neuropathology & Experimental Neurology. 1 juin, vol.77, issue.6, pp.422-427, 2018.

M. Mellai, L. Annovazzi, R. Senetta, C. Dell'aglio, M. Mazzucco et al., Diagnostic revision of 206 adult gliomas (including 40 oligoastrocytomas) based on ATRX, IDH1/2 and 1p/19q status, Journal of Neuro-Oncology. janv, vol.131, issue.2, pp.213-235, 2017.

D. N. Louis, P. Wesseling, W. Paulus, C. Giannini, T. T. Batchelor et al., cIMPACT-NOW update 1: Not Otherwise Specified (NOS) and Not Elsewhere Classified (NEC), Acta Neuropathologica. mars, vol.135, issue.3, pp.481-485, 2018.
URL : https://hal.archives-ouvertes.fr/hal-01735097

S. Nobusawa, T. Watanabe, P. Kleihues, and H. Ohgaki, IDH1 Mutations as Molecular Signature and Predictive Factor of Secondary Glioblastomas, Clinical Cancer Research, vol.15, pp.6002-6009, 2009.

A. Olar, K. M. Wani, K. D. Alfaro-munoz, L. E. Heathcock, H. F. Van-thuijl et al., IDH mutation status and role of WHO grade and mitotic index in overall survival in grade II-III diffuse gliomas, Acta Neuropathologica. avr, vol.129, issue.4, pp.585-96, 2015.

Y. Akagi, K. Yoshimoto, N. Hata, D. Kuga, R. Hatae et al., Reclassification of 400 consecutive glioma cases based on the revised 2016WHO classification, Brain Tumor Pathology. avr, vol.35, issue.2, pp.81-90, 2018.

H. Suzuki, K. Aoki, K. Chiba, Y. Sato, Y. Shiozawa et al., Mutational landscape and clonal architecture in grade II and III gliomas, Nature Genetics. mai, vol.47, issue.5, pp.458-68, 2015.

M. Shirahata, T. Ono, D. Stichel, D. Schrimpf, D. E. Reuss et al., Novel, improved grading system(s) for IDH-mutant astrocytic gliomas, Acta Neuropathologica. juill, vol.136, issue.1, pp.153-66, 2018.

, Test Description

D. Sur,

P. J. Cimino, M. Zager, L. Mcferrin, H. Wirsching, H. Bolouri et al., Multidimensional scaling of diffuse gliomas: application to the 2016 World Health Organization classification system with prognostically relevant molecular subtype discovery, Acta Neuropathologica Communications, 2017.

,

, Amorce sens : CCGAATGACAAGGTGAGACT Amorce anti-sens : AATGTTGTTTCCAAAGTGGC Taille du produit de PCR, pp.1-226

, Amorce sens : GCTAGTCAGGCATGAGCG Reverse primer: GGTCACTTGACATTCGTGG Taille du produit de PCR, pp.90-106

, Amorce sens : GCCCATTTTGAATTGGATTA Amorce anti-sens : AAGACAAGCCATAGACTTGGAA Taille du produit de PCR, pp.159-171

, Amorce sens : GGTTCAAGGGATTCTCCTG Amorce anti-sens : TGGCACTCAGACCTCAA Taille du produit de PCR, pp.108-134

, Amorce sens : CCTGGGCAACAGAATAAGAT Amorce anti-sens : TAGGTTTTTAAGGAACAGGTGG Taille du produit de PCR, pp.199-221