Primary brain tumours in adults, Lancet. 26 mai, vol.379, issue.9830, pp.1984-96, 2012. ,
, Epidemiology of Intracranial Gliomas, vol.30, p.11, 2018.
WHO Classification of Tumours of the Central Nervous System, Acta Neuropathol. août, vol.114, issue.2, pp.97-109, 2007. ,
Interobserver variation of the histopathological diagnosis in clinical trials on glioma: a clinician's perspective, Acta Neuropathologica. sept, vol.120, issue.3, pp.297-304, 2010. ,
The 2016 World Health Organization Classification of Tumors of the Central Nervous System: a summary, Acta Neuropathologica. juin, vol.131, issue.6, pp.803-823, 2016. ,
URL : https://hal.archives-ouvertes.fr/hal-01479018
International Society of Neuropathology-Haarlem Consensus Guidelines for Nervous System Tumor Classification and Grading: ISN-Haarlem Brain Tumor Classification Guidelines, Brain Pathology. sept, vol.24, issue.5, pp.429-464, 2014. ,
WHO classification of tumours of the central nervous system, vol.408, 2016. ,
IDH Mutation in Glioma: New Insights and Promises for the Future, JAMA Neurology, vol.71, issue.10, p.1319, 2014. ,
Molecular Classification of Low-Grade Diffuse Gliomas, The American Journal of Pathology. déc, vol.177, issue.6, pp.2708-2722, 2010. ,
Alterations of chromosome arms 1p and 19q as predictors of survival in oligodendrogliomas, astrocytomas, and mixed oligoastrocytomas, J Clin Oncol. févr, vol.18, issue.3, pp.636-681, 2000. ,
Two types of chromosome 1p losses with opposite significance in gliomas, Ann Neurol. sept, vol.58, issue.3, pp.483-490, 2005. ,
URL : https://hal.archives-ouvertes.fr/inserm-00310519
Genetic profile of astrocytic and oligodendroglial gliomas, Brain Tumor Pathology. juill, vol.28, issue.3, pp.177-83, 2011. ,
Dynamic history of low-grade gliomas before and after temozolomide treatment, Annals of Neurology. mai, vol.61, issue.5, pp.484-90, 2007. ,
ATRX and IDH1-R132H immunohistochemistry with subsequent copy number analysis and IDH sequencing as a basis for an "integrated" diagnostic approach for adult astrocytoma, oligodendroglioma and glioblastoma, Acta Neuropathologica. janv, vol.129, issue.1, pp.133-179, 2015. ,
ATRX immunostaining predicts IDH and H3F3A status in gliomas, Acta Neuropathologica Communications, vol.4, issue.1 ,
Prognostic impact of the 2016 WHO classification of diffuse gliomas in the French POLA cohort, Acta Neuropathologica, vol.132, issue.4, pp.625-659, 2016. ,
, , 2009.
,
,
, Concomitant IDH wild-type glioblastoma and IDH1 -mutant anaplastic astrocytoma in a patient with constitutional mismatch repair deficiency syndrome, Neuropathology and Applied Neurobiology. févr, vol.44, issue.2, pp.233-242, 2018.
Diffuse Astrocytoma, IDH-Wildtype: A Dissolving Diagnosis, Journal of Neuropathology & Experimental Neurology. 1 juin, vol.77, issue.6, pp.422-427, 2018. ,
Diagnostic revision of 206 adult gliomas (including 40 oligoastrocytomas) based on ATRX, IDH1/2 and 1p/19q status, Journal of Neuro-Oncology. janv, vol.131, issue.2, pp.213-235, 2017. ,
cIMPACT-NOW update 1: Not Otherwise Specified (NOS) and Not Elsewhere Classified (NEC), Acta Neuropathologica. mars, vol.135, issue.3, pp.481-485, 2018. ,
URL : https://hal.archives-ouvertes.fr/hal-01735097
IDH1 Mutations as Molecular Signature and Predictive Factor of Secondary Glioblastomas, Clinical Cancer Research, vol.15, pp.6002-6009, 2009. ,
IDH mutation status and role of WHO grade and mitotic index in overall survival in grade II-III diffuse gliomas, Acta Neuropathologica. avr, vol.129, issue.4, pp.585-96, 2015. ,
Reclassification of 400 consecutive glioma cases based on the revised 2016WHO classification, Brain Tumor Pathology. avr, vol.35, issue.2, pp.81-90, 2018. ,
Mutational landscape and clonal architecture in grade II and III gliomas, Nature Genetics. mai, vol.47, issue.5, pp.458-68, 2015. ,
Novel, improved grading system(s) for IDH-mutant astrocytic gliomas, Acta Neuropathologica. juill, vol.136, issue.1, pp.153-66, 2018. ,
, Test Description
,
Multidimensional scaling of diffuse gliomas: application to the 2016 World Health Organization classification system with prognostically relevant molecular subtype discovery, Acta Neuropathologica Communications, 2017. ,
,
, Amorce sens : CCGAATGACAAGGTGAGACT Amorce anti-sens : AATGTTGTTTCCAAAGTGGC Taille du produit de PCR, pp.1-226
, Amorce sens : GCTAGTCAGGCATGAGCG Reverse primer: GGTCACTTGACATTCGTGG Taille du produit de PCR, pp.90-106
, Amorce sens : GCCCATTTTGAATTGGATTA Amorce anti-sens : AAGACAAGCCATAGACTTGGAA Taille du produit de PCR, pp.159-171
, Amorce sens : GGTTCAAGGGATTCTCCTG Amorce anti-sens : TGGCACTCAGACCTCAA Taille du produit de PCR, pp.108-134
, Amorce sens : CCTGGGCAACAGAATAAGAT Amorce anti-sens : TAGGTTTTTAAGGAACAGGTGG Taille du produit de PCR, pp.199-221